Store

Intestinal Cobalamin Malabsorption (Giant Schnauzer Type)

$50

(ONLINE PRICE)

Test Overview:

Intestinal Cobalamin Malabsorption (Giant Schnauzer Type) affects dogs and is an inherited disease. Dogs affected with this disease are unable to produce adequate amounts of a protein that play a part in absorption of certain nutrients from the intestinal tract and kidneys, including the B vitamin, cobalamin. Symptoms can begin as early as 6 to 12 weeks of age and can include anorexia, lethargy, poor weight gain, and poor muscle mass. In rare scenarios, a severe neurological dysfunction called hepatic encephalopathy may develop leading to an altered mental state, seizures, coma and death. From a young age, dogs with this disease can have increased levels of methylmalonic acid, and an increase in certain proteins in their urine (which is a sign of cobalamin deficiency). Decreased production of blood cells in affected dogs results in Anemia and decreased numbers of neutrophils, a type of white blood cell. Affected dogs will require cobalamin supplementation for life. Most animals respond to treatment within a few weeks. Although not associated with the clinical disease, affected dogs will continue to pass increased amounts of certain proteins in their urine even with cobalamin supplementation.

Category:

Digestive system / Gastrointestinal - Associated with the organs and structures of the digestive system

Gene:

AMN

Variant Detected:

chr8:70807271-70807303 (canFam3): 33 bp deletion (del CGGGCTGCTGCTGCTGCTGCTGGCGCTGGCGGC)

Severity:

Moderate. This disease can cause significant signs of discomfort and/or dysfunction in affected animals. It may involve relatively high treatment/management costs, and can sometimes reduce life expectancy.

Mode of Inheritance:

Autosomal Recessive

Recommended Screening:

Genetic testing of the AMN will reliably determine if a dog is a genetic carrier of intestinal cobalamin malabsorption (giant schnauzer type).

Research Citation(s):

https://pubmed.ncbi.nlm.nih.gov/26483576/ Fyfe JC, Jezyk PF, Giger U, Patterson DF. Inherited Selective Malabsorption of Vitamin B12 in Giant Schnauzers. J Am Anim Hosp Assoc. 1989;25:533–539. [Not in PubMed] He Q, Madsen M, Kilkenney A, Gregory B, Christensen EI, Vorum H, Hojrup P, Schaffer AA, Kirkness EF, Tanner SM, de la Chapelle A, Giger U, Moestrup SK, Fyfe JC. Amnionless function is required for cubilin brush-border expression and intrinsic factor-cobalamin (vitamin B12) absorption in vivo. Blood. 2005 Aug 15;106(4):1447-53. [PubMed: 15845892]

##parent-placeholder-19bd1503d9bad449304cc6b4e977b74bac6cc771##